Description |
HPLC purified SafeEdit sgRNA with modifications targeting the first exon of house-keeping gene RAB11A, member RAS oncogene family [Homo sapiens (human)]
For customized sgRNA synthesis service, please visit: //www.genscript.com/crispr-cas9-single-guide-RNA-and-ribonucleoprotein.html
[Reference] Roth. et al. Reprogramming human T cell function and specificity with non-viral genome targeting. Nature 2018, 559(7714): 405-409. |
Sequence |
mG*mG*mU*AGUCGUACUCGUCGUCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAA UAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU*mU*mU*mU m=2'O-Methyl RNA; *=Phosphorothioate |
Storage Condition |
Stable for at least 12 months at -20°C. Avoid repeated freeze-thaw cycles. |
Quality Specifications |
Item |
Specifications |
Molecular Weight |
≤+/- 0.05% from theoretical molecular weight by mass spectrometry |
Purity |
≥90% by RNase-free HPLC |
|